View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13744_low_16 (Length: 211)
Name: NF13744_low_16
Description: NF13744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13744_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 745345 - 745521
Alignment:
| Q |
15 |
agcagagagattagttttgaaatgatttgtattgttgaaaggtaagaagcacgttttgatggatctggatcgaagagattctggtaaagaagcgctgttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
745345 |
agcagagagattagttttgaaatgatttgtattgttgaaaggtaagaagcatgttttgatggatctggatcgaagagattctggtaaagaagcgctgttt |
745444 |
T |
|
| Q |
115 |
gtgtttggtgttgtgatcttagaaactgaaagcgaagaagccattgttgaaaatgaaaattgttacaactatctcgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
745445 |
gtgtttggtgttgtgatcttagaaactgaaagtgaagaagccattgttgaaaatgaaaattgttacaactatctcgt |
745521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University