View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13745_high_1 (Length: 690)
Name: NF13745_high_1
Description: NF13745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13745_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 456; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 456; E-Value: 0
Query Start/End: Original strand, 179 - 674
Target Start/End: Complemental strand, 46724491 - 46723996
Alignment:
| Q |
179 |
ccacaacaatggttcctcactttacccaccactctccgtcaacactactccaatggccgcaccatcaaagtccaaattcaccccaaccaacaatccatct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46724491 |
ccacaacaatggttcctcactttacccaccactctccgtcaacactactccaatggccgcaccatcaaagtccaaattcaccccaaccaacaacccatcc |
46724392 |
T |
 |
| Q |
279 |
acctcttcaccttccaactcgaccccaccattcccaacccttcagaaactgttctcattcttcatggtcaagctctcagttcatattcttatcgcaatct |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46724391 |
acctcttcaccttccaactcgaccccaccattcccaacccttcagaaactgttctcattcttcatggtcaagctctcagttcatattcttatcgcaatct |
46724292 |
T |
 |
| Q |
379 |
cattcaatctcttagcacacaaggtgttcgtgttattgccatcgaccttcctggaagcggattttcagataaatcagtagaagtttcagttgagggattg |
478 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46724291 |
cattcaatctcttagcacacaaggtgttcgtgttattgccatcgaccttcctggaagcggattttcagataaatcagtagaagtttcagttgagggattg |
46724192 |
T |
 |
| Q |
479 |
gatgggatttttgggaggttaagttatgtttatagtgagattaaagaaaagggnnnnnnnngggcttttgatcaaattgttgaaactggtcaaatccctt |
578 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46724191 |
gatgggatttttgggaggtttagttatgtttatagtgagattaaagaaaagggttttttttgggcttttgatcaaattgttgaaactggtcaaatccctt |
46724092 |
T |
 |
| Q |
579 |
acgaggaagttctagctagaatgtcaaagaggaaagtgaataaacctattgatttaggtcctgaagagattggaaaagttttgggagaggttattg |
674 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46724091 |
atgaggaagttctagctagaatgtcaaagaggaaagtgaataaacctattgatttaggtcctgaagagattggaaaagttttgggagaggttattg |
46723996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University