View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13745_high_6 (Length: 244)

Name: NF13745_high_6
Description: NF13745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13745_high_6
NF13745_high_6
[»] chr7 (1 HSPs)
chr7 (1-191)||(46136436-46136626)


Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 46136436 - 46136626
Alignment:
1 gccctttgtggtagttgcatttagctgatgtccagatttttcgcagatgagacttgacttcaaagggaagttatattcctagtcgttatttaccacgcgg 100  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
46136436 gccctttgtggtagttgcatttagctgatgtcaagatttttcgcagatgagacttgacttcaaagggaagttatattcctagtcgttatttaccacacgg 46136535  T
101 aatgtaacatataagagttggtgaaatgccatagtggatgaatgtttgccatggcagtgaaaaggcttcactctagtgttagtaaacagag 191  Q
    |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
46136536 aatggaacatataagagtcggtgaaatgccatagtggatgaatgtttgccatggcagtgaaaaggcttcgctctagtgttagtaaacagag 46136626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University