View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13745_high_9 (Length: 209)

Name: NF13745_high_9
Description: NF13745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13745_high_9
NF13745_high_9
[»] chr3 (1 HSPs)
chr3 (1-177)||(47600385-47600561)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 47600561 - 47600385
Alignment:
1 aaaggtggttacgatctgtggtccacgtgatgcggtggtttctattgagagtgaagcgtaagtgagggacaaaggtggtagtggaaatgtagatttgtta 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47600561 aaaggtggttacgatctgtggtccacgtgatgcggtggtttttattgagagtgaagcgtaagtgagggacaaaggtggtagtggaaatgtagatttgtta 47600462  T
101 ataccaattacctctccagactctcaccggatttcttcaccacggaggaggagttagaatttttacgcgggtcccac 177  Q
    |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
47600461 ataccaattacctctctagactctcaccgggtttcttcaccacggaggaggagttagaatttttacgcgggtcccac 47600385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University