View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13745_low_10 (Length: 236)
Name: NF13745_low_10
Description: NF13745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13745_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 21328220 - 21328425
Alignment:
| Q |
16 |
gattttcctgagatgccccataattctatttgacaacattggatggcatattcgaattttcactattggccgccatttgtcagctacaattgctactaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21328220 |
gattttcctgagatgccccataattctatttgacaacattggatggcatattcgaattttcactattggccgccatttgtcagctacaattgctactaaa |
21328319 |
T |
 |
| Q |
116 |
aacacaactcaatggaattttgcatagcgcctaggggccgctgcaagaggaataaccttaaaaccccaaactgctatgtgattcacaagcaacatgtggt |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21328320 |
aacacaactcaacggaattttgcatagcgcctaggggccgctacaagaggtataaccttaaaaccccaaactgctatgtgattcacaagcaacatgtggt |
21328419 |
T |
 |
| Q |
216 |
cctttg |
221 |
Q |
| |
|
|||||| |
|
|
| T |
21328420 |
cctttg |
21328425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University