View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13745_low_7 (Length: 244)
Name: NF13745_low_7
Description: NF13745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13745_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 10 - 225
Target Start/End: Complemental strand, 21742998 - 21742783
Alignment:
| Q |
10 |
attatacttggttgttttgatctatgcagccatcagcagcaaatactgatgcaagttgtgactcagtagttactactcctcagaattctaagagagatgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21742998 |
attatacttggttgttttgatctatgcagccatcagcagcaaatactgatgcaagttgtgactcagtagttactactcctcagaattctaagagagatgc |
21742899 |
T |
 |
| Q |
110 |
tactaaccctgctgggtaatttgaaggcttatgaaatgaacttcttgtgannnnnnnnctgtgttgaagatttcctaannnnnnnnctattgtgtaatca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| | ||||| |
|
|
| T |
21742898 |
tactaaccctgctgggtaatttgaaggcttatgaaatgaacttcttgtgattttttttctgtgttgaagatttcctaattttttttctattgcgcaatca |
21742799 |
T |
 |
| Q |
210 |
tttgcagactcctatc |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
21742798 |
tttgcagactcctatc |
21742783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University