View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13745_low_8 (Length: 244)
Name: NF13745_low_8
Description: NF13745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13745_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 46136436 - 46136626
Alignment:
| Q |
1 |
gccctttgtggtagttgcatttagctgatgtccagatttttcgcagatgagacttgacttcaaagggaagttatattcctagtcgttatttaccacgcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46136436 |
gccctttgtggtagttgcatttagctgatgtcaagatttttcgcagatgagacttgacttcaaagggaagttatattcctagtcgttatttaccacacgg |
46136535 |
T |
 |
| Q |
101 |
aatgtaacatataagagttggtgaaatgccatagtggatgaatgtttgccatggcagtgaaaaggcttcactctagtgttagtaaacagag |
191 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46136536 |
aatggaacatataagagtcggtgaaatgccatagtggatgaatgtttgccatggcagtgaaaaggcttcgctctagtgttagtaaacagag |
46136626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University