View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13746_high_6 (Length: 207)
Name: NF13746_high_6
Description: NF13746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13746_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 110 - 187
Target Start/End: Complemental strand, 3688804 - 3688727
Alignment:
| Q |
110 |
ttcaccttcacgagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttcacttttcc |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3688804 |
ttcaccttcaggagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttgacttttcc |
3688727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University