View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13746_low_7 (Length: 265)
Name: NF13746_low_7
Description: NF13746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13746_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 93 - 250
Target Start/End: Complemental strand, 41732505 - 41732348
Alignment:
| Q |
93 |
ttagtcttattatatcacaagctggcgaataaaaaagccatgaagcaattagccatcaaataaaaagttcatgcttccgtcaaaagaagaaattcatggc |
192 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732505 |
ttagtctcattatatcacaagctggcgaataaaaaagccatgaggcaattagccatcaaataaaaagttcatgcttccgtcaaaagaagaaattcatggc |
41732406 |
T |
|
| Q |
193 |
ttgatggtggaatataaattattattttttgaaaaagaaataaattattcaagtaaat |
250 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41732405 |
ttgatgatggaatataaattattattttttgaaaaagaaataaattattgaagtaaat |
41732348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 14 - 75
Target Start/End: Complemental strand, 41732778 - 41732717
Alignment:
| Q |
14 |
gaaggcgatttgcagcttttctttacttaatgtgaatacaatccacttattagttgttattt |
75 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732778 |
gaaggcgatttgcagcttttcttttcttaatgtgaatacaatccacttattagttgttattt |
41732717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University