View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13747_high_10 (Length: 266)

Name: NF13747_high_10
Description: NF13747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13747_high_10
NF13747_high_10
[»] chr1 (1 HSPs)
chr1 (11-168)||(28850169-28850326)
[»] chr3 (1 HSPs)
chr3 (120-209)||(21311110-21311199)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 11 - 168
Target Start/End: Complemental strand, 28850326 - 28850169
Alignment:
11 catcatcaccccaaataaaacctctttgcaacttctgaatctcatgaagatacgatttaggaataacacaactcatcatcggataaataggaactgcttc 110  Q
    |||| ||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||  |||||||||    
28850326 catcctcaccccaaataaaatctctttgcaacttctgaatctcataaagacacgatttaggaataacacaactcatcatcggataaataaaaactgcttc 28850227  T
111 aataaatgatttagcaaaagtcactctaccagcaaaggaaagatgttttgctttccat 168  Q
    ||||| ||||||||||| |||||||| |||  |||||||||||||||||||| |||||    
28850226 aataactgatttagcaagagtcactcaaccgacaaaggaaagatgttttgctatccat 28850169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 120 - 209
Target Start/End: Original strand, 21311110 - 21311199
Alignment:
120 tttagcaaaagtcactctaccagcaaaggaaagatgttttgctttccatgacaccagtttatttctcacttgatcaataatatactgaaa 209  Q
    |||||| ||||| ||||| || | ||||||||| ||||| |||||||| | ||  || ||||| || |||||||||| ||||||||||||    
21311110 tttagccaaagtaactctccctggaaaggaaagttgtttagctttccaggccataagcttattgctgacttgatcaacaatatactgaaa 21311199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University