View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13747_high_4 (Length: 469)
Name: NF13747_high_4
Description: NF13747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13747_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-168; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 19 - 318
Target Start/End: Original strand, 38939783 - 38940082
Alignment:
| Q |
19 |
atattctctaacaaactcgatgaagtagttacaccagtgggatatataaagttctctgttcccacttcttcaacattcatcgagaattccttcaatcacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38939783 |
atattctctaacaaactcgatgaagtagttacaccagtgggatatataaagttctctgttcccacttcttcaacattcatcgagaattccttcaatcacc |
38939882 |
T |
|
| Q |
119 |
gttgcttcatctcatccaaaaacggttacagctttcagcgattttcaggtaacattcgttatcgctattttccttttcgttttccgtgaatccttgttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38939883 |
gttgcttcatctcatccaaaaacggttacagctttcagcgattttcaggtaacattcgttatcgctattttccttttcgttttccgtgaatccttgttga |
38939982 |
T |
|
| Q |
219 |
tgatgatgaatctctacggtaacattcatcatcattacttcgttttcttttgtttatgatgctgctgatgaatctttcttcgttccgtttcaggttttag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38939983 |
tgatgatgaatctctacggtaacattcatcatcattacttcgttttcttttgtttatgatgctgctgatgaatctttcttcgttccgtttcaggttttag |
38940082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 295 - 360
Target Start/End: Original strand, 38940216 - 38940281
Alignment:
| Q |
295 |
tcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940216 |
tcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
38940281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 426 - 469
Target Start/End: Original strand, 38940347 - 38940390
Alignment:
| Q |
426 |
gtctgcacttgatatactgtatgaatattttggtttctagttct |
469 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38940347 |
gtctgcacttgatatactgtatgaatattttggtttctatttct |
38940390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 87; Significance: 2e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 44 - 318
Target Start/End: Complemental strand, 55759865 - 55759596
Alignment:
| Q |
44 |
tagttacaccagtgggatatataaagttctctgttcccacttcttcaacattcatcgagaattccttcaatcaccgttgcttcatctcatccaa-aaacg |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||| ||||||| || |||||| |||||||||| ||||| |
|
|
| T |
55759865 |
tagttacaccagtgggatatataaagttctcagttccctcttcttcaacattcatcgtgaaa-ccttcaagca---ttgctttctctcatccaagaaacg |
55759770 |
T |
|
| Q |
143 |
gttacagc--tttcagcgattttcaggtaacattcgttatcgctattttccttttcgttttccgtgaatccttgttgatgatgatgaatctctacggtaa |
240 |
Q |
| |
|
||| ||| ||||| ||||| |||||||||| |||||||||||| | ||||||||||| ||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
55759769 |
gtttcagtgttttca----ttttctggtaacattcattatcgctatttgc-ttttcgttttca-tgactccttattgatgatgatgaatctttacggtaa |
55759676 |
T |
|
| Q |
241 |
cattcatcatcattacttcgttttct--tttgtttatgatgctgctgatgaatctttcttcgttccgtttcaggttttag |
318 |
Q |
| |
|
||||||||||||||| |||||||| | | || | ||| |||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
55759675 |
cattcatcatcattatttcgttttatgaatgcttgttcatgatgctgatgaatcttccttcgttccatttcaggttttag |
55759596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University