View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13747_low_14 (Length: 266)
Name: NF13747_low_14
Description: NF13747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13747_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 11 - 168
Target Start/End: Complemental strand, 28850326 - 28850169
Alignment:
| Q |
11 |
catcatcaccccaaataaaacctctttgcaacttctgaatctcatgaagatacgatttaggaataacacaactcatcatcggataaataggaactgcttc |
110 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28850326 |
catcctcaccccaaataaaatctctttgcaacttctgaatctcataaagacacgatttaggaataacacaactcatcatcggataaataaaaactgcttc |
28850227 |
T |
 |
| Q |
111 |
aataaatgatttagcaaaagtcactctaccagcaaaggaaagatgttttgctttccat |
168 |
Q |
| |
|
||||| ||||||||||| |||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
28850226 |
aataactgatttagcaagagtcactcaaccgacaaaggaaagatgttttgctatccat |
28850169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 120 - 209
Target Start/End: Original strand, 21311110 - 21311199
Alignment:
| Q |
120 |
tttagcaaaagtcactctaccagcaaaggaaagatgttttgctttccatgacaccagtttatttctcacttgatcaataatatactgaaa |
209 |
Q |
| |
|
|||||| ||||| ||||| || | ||||||||| ||||| |||||||| | || || ||||| || |||||||||| |||||||||||| |
|
|
| T |
21311110 |
tttagccaaagtaactctccctggaaaggaaagttgtttagctttccaggccataagcttattgctgacttgatcaacaatatactgaaa |
21311199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University