View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13747_low_15 (Length: 244)
Name: NF13747_low_15
Description: NF13747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13747_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 38358005 - 38357793
Alignment:
| Q |
18 |
gatacaacgttgctttcttgtacttgttcagattttgttgtttttggtgttgatgtgttctctaattttaaccttttttcaacctaggtaccaaattaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38358005 |
gatacaacgttgctttcttgtacttgttcagattttgttgtttttggtgttgatgtgttctctaattttaaccttttttcaacctaggtaccaaattaat |
38357906 |
T |
 |
| Q |
118 |
aatctattcattg-nnnnnnnnnttgtaagaacaacgtttaaagatgttaaaattgtgatttcatacctgtcttaacgatgagaagaatttcgaataggt |
216 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357905 |
aatctattaattgaaaacaaaaattgtaagaacaacgtttaaagatgttaaaattgtgatttcatacctgtcttaacgatgagaagaatttcgaatagga |
38357806 |
T |
 |
| Q |
217 |
ggaagacattgat |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38357805 |
ggaagacattgat |
38357793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University