View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13747_low_17 (Length: 209)
Name: NF13747_low_17
Description: NF13747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13747_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 29 - 199
Target Start/End: Original strand, 32758180 - 32758350
Alignment:
| Q |
29 |
ttcattcattcagtgtaagtggacggacaatcgcaggcagacagagtagagagaaaacgatggcttgcaggcagttatgggcttcaagagcagcatcata |
128 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32758180 |
ttcattcattcagtgtaagtggacaatcaatcgcaggcagacagagtagagagaaaaagatggcttgcaggcagttatgggcttcaagagcagcatcata |
32758279 |
T |
 |
| Q |
129 |
cctcaggatctctctctttcacagaagcttctctaacggtattcattctttgatctctttttcatctcact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32758280 |
cctcaggatctctctctttcacagaagcttctctaacggtattcattctttgatctctttttcatttcact |
32758350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University