View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13748_high_1 (Length: 326)
Name: NF13748_high_1
Description: NF13748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13748_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 104 - 316
Target Start/End: Original strand, 48397663 - 48397875
Alignment:
| Q |
104 |
catatagttttcatatgctgattagttgtttgtttgctctgagcagcaagcagaagttcagataaaaagaagaatcgggattgggaaccacatatcagaa |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48397663 |
catataggtttcatatgctgattagttgtttgtttgctctgagcagcaagcagaagttcagataaagagaagaatcgggattgggaaccacatatcagaa |
48397762 |
T |
|
| Q |
204 |
agaagactgattgatgatctcggcagaatggggatgaatgaatctattgtaagtacttcttagccacttagctgagaagaaagtcatagcttataaacca |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397763 |
agaagactgattgatgatctcggcagaatggggatgaatgaatctattgtaagtactgcttagccacttagctgagaagaaagtcatagcttataaacca |
48397862 |
T |
|
| Q |
304 |
gagtttgatgatg |
316 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48397863 |
gagtttgatgatg |
48397875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 2 - 111
Target Start/End: Original strand, 48396781 - 48396890
Alignment:
| Q |
2 |
taagtatcgctgttattcttttctgggtaccttttgtccatacctcctggtgcattttcattaaaatttcaaaacacagtactgatatagattataggat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48396781 |
taagtatcgctgttattcttttctgggtaccttttgtccatacctcctggtgcattttcattaaaatttcaaaacacagtactgatatagattataggat |
48396880 |
T |
|
| Q |
102 |
gtcatatagt |
111 |
Q |
| |
|
|||| ||||| |
|
|
| T |
48396881 |
gtcacatagt |
48396890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University