View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13748_low_1 (Length: 485)
Name: NF13748_low_1
Description: NF13748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13748_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 14181330 - 14181126
Alignment:
| Q |
19 |
gtatctactacatatacctaattaatactccctcttcaagtcataaacatacacaaacataagtacttacatctccatgacacttaaaatgaaaagtaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14181330 |
gtatctactacatatacctaattaatactccctcttcaagtcataaacatacacaaacataagtacttacatctccatgacacttaaaatgaaaagtaaa |
14181231 |
T |
|
| Q |
119 |
ttattataaaatgtccagaatcaagctgcaggatatatggtacggcatgattgatatttccataattccatgttactctgcaagtcacaattccacaaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14181230 |
ttattataaaatgtccagaatcaagctgcaggatatatggtacgacatgatcgatatttccataattccatgttactctgcaagtcacaattccacaaac |
14181131 |
T |
|
| Q |
219 |
atgtc |
223 |
Q |
| |
|
||||| |
|
|
| T |
14181130 |
atgtc |
14181126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 303 - 473
Target Start/End: Complemental strand, 14181046 - 14180876
Alignment:
| Q |
303 |
gatatttatgggtgatcgaggtccctagtcttgagattataatcttgaaaaactggctgaccaagctgaagatagggattaacaggtgcagcaagttgaa |
402 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14181046 |
gatatttaagggtgatcgaggtccctagtcttgagattataatcttgaaaaactggctgaccaagctgaagatagggattaacaggtgcagcaagttgaa |
14180947 |
T |
|
| Q |
403 |
ggatcctgctaagtggttggtcctcaaaaaatgcaaactgatccatcacagccttgttttccatcactgcc |
473 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14180946 |
ggatcctgctaagtggttggtcctcaaaaaatgcaaactgatccatcacagccttgttttccatcactgcc |
14180876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University