View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13749_high_3 (Length: 258)
Name: NF13749_high_3
Description: NF13749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13749_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 101 - 207
Target Start/End: Original strand, 34926824 - 34926930
Alignment:
| Q |
101 |
ttcaaacttctattttagaaatcctagaagcaaaagctcaagaaaaggtttactaagaagtaagaactaggttagaatagataatcaaaattctactagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34926824 |
ttcaaacttctattttagaaatcctagaagcaaaagctcaagaaaaggtttactaagaagtaagaactaggttagaatagataatcaaaattctactagg |
34926923 |
T |
 |
| Q |
201 |
aaaattt |
207 |
Q |
| |
|
||||||| |
|
|
| T |
34926924 |
aaaattt |
34926930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 34926723 - 34926786
Alignment:
| Q |
1 |
cataaaatcgaaaaataccctgaatcaagaacattcaattaaaatcttaaatattttggagctt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
34926723 |
cataaaatcgaaaaataccctgaatcaagaacattcaattaaaatctaaaatattttggggctt |
34926786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University