View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1374_high_3 (Length: 363)
Name: NF1374_high_3
Description: NF1374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1374_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 30 - 351
Target Start/End: Complemental strand, 14527027 - 14526706
Alignment:
| Q |
30 |
gtcctgtccctgtaactgctgtgccgaagccggtactgcgcatctgctcgctaatcttctccatagtcgcaacaaaattcggaacaaagatgcttgtgtt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14527027 |
gtcctgtccctgtaactgctgtgccgaagccggtactgcgcatctgctcgctaatcttctccatagttgcaacaaaattcggaacaaagatgcttgtgtt |
14526928 |
T |
 |
| Q |
130 |
atgctctacttgatggccacatgttatcataactgtctctgctcttggttctgctattatagtttctgatagtagtacaaacttgattagaagtagtttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14526927 |
atgctctacttgatggccacatgttatcataactgtctttgctcttggttctgctattatagtttctgatagtagtacaaacttgattagaagtagtttg |
14526828 |
T |
 |
| Q |
230 |
aggcattgagaaaatatgagagggactggtttcttcattttctggatggtccaatctgaatcactttctttggttgattatattgtttacaatatttatg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14526827 |
aggcattgagaaaatatgagagggactggtttcttcattttctggatggtccaatctgaatcactttctttggttgattatattgtttacaatatttatg |
14526728 |
T |
 |
| Q |
330 |
atcttagtacacagattatatt |
351 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
14526727 |
atcttagtacactgattatatt |
14526706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University