View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1374_high_4 (Length: 333)
Name: NF1374_high_4
Description: NF1374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1374_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 56 - 326
Target Start/End: Original strand, 2972315 - 2972585
Alignment:
| Q |
56 |
gagcaattgatatcttaacttgttaaatgcaacttgttaaatttttatgtttgatggagactagggttttaaataaaggtctgcagctgcaatctgggtc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2972315 |
gagcaattgatatcttaacttgttaaatgcaactagttaaatttgtatgtttgatggagactagggttttaaataaaggtctgcagccgcaatctgggtc |
2972414 |
T |
 |
| Q |
156 |
gcgacataacannnnnnnatgttgagagattgccagattaccgttactgataacatcttgatagtcaagatagtaacgtcttgatagtcaagatacgatc |
255 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2972415 |
gcgacataacatttttttatgttgagagattcccagattaccgttactgataacaacttgatagtcaagatagtaacgtcttgatagtcaagatacgatc |
2972514 |
T |
 |
| Q |
256 |
ttatacatgattatgcgatgaaatttacaaagcaaagtacatcataatcaagttagatatgatattcttgg |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
2972515 |
ttatacatgattatgcgatgaaatttacaaagcaaagtacatcacaatcaagttagatatgattttcttgg |
2972585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 238
Target Start/End: Complemental strand, 25160265 - 25160233
Alignment:
| Q |
206 |
taacatcttgatagtcaagatagtaacgtcttg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
25160265 |
taacatcttgatagtcaagatagtaacgacttg |
25160233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University