View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1374_high_7 (Length: 203)
Name: NF1374_high_7
Description: NF1374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1374_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 21 - 157
Target Start/End: Complemental strand, 14527027 - 14526891
Alignment:
| Q |
21 |
gtcctgtccctgtaactgctgtgccgaagccggtactgcgcatctgctcgctaatcttctccatagtcgcaacaaaattcggaacaaagatgcttgtgtt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14527027 |
gtcctgtccctgtaactgctgtgccgaagccggtactgcgcatctgctcgctaatcttctccatagttgcaacaaaattcggaacaaagatgcttgtgtt |
14526928 |
T |
 |
| Q |
121 |
atgctctacttgatggccacatgttatcataactgtc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14526927 |
atgctctacttgatggccacatgttatcataactgtc |
14526891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University