View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1374_low_16 (Length: 234)

Name: NF1374_low_16
Description: NF1374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1374_low_16
NF1374_low_16
[»] chr3 (1 HSPs)
chr3 (111-160)||(1158514-1158563)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 1158563 - 1158514
Alignment:
111 gaaaagaaagtagtatcagataaatggtctttgctacttcagcattatat 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
1158563 gaaaagaaagtagtatcagataaatggtctttgctacttcagcattatat 1158514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University