View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1374_low_4 (Length: 440)
Name: NF1374_low_4
Description: NF1374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1374_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 172 - 432
Target Start/End: Complemental strand, 4532321 - 4532061
Alignment:
| Q |
172 |
aagcttttgccttcttctccatcatatgtgacctctttcttcgggcgaacgagggttgtatgcaaatgcgtgctatggcgctcaagtcagtgagtggcat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4532321 |
aagcttttgccttcttctccatcatatgtgacctctttcttcgggcgaacgagggttgtatgcaaatgcgtgctatggcgctcaagtcagtgagtgacat |
4532222 |
T |
|
| Q |
272 |
aagatgatacactatttgcacagagtgaatgtatctgacccatgtatatgagccaataatggaggtttgaggatttggtcgttgtacctttgcatggaca |
371 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
4532221 |
aagatgatacactatttgtatagagtgaatgtatctgacccatgtatatgagccaataatggaggtttgaggatttggtccttgtacctttgcatgaaca |
4532122 |
T |
|
| Q |
372 |
actgttcttggaggacaatcatagtcctttgagaggcagctgtgggtgtctggtctgtggt |
432 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4532121 |
actgttcttgaaggacaatcatagtcctttgagaggcagttgtgggtgtctggtctgtggt |
4532061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 331 - 406
Target Start/End: Original strand, 49191551 - 49191626
Alignment:
| Q |
331 |
tggaggtttgaggatttggtcgttgtacctttgcatggacaactgttcttggaggacaatcatagtcctttgagag |
406 |
Q |
| |
|
||||||||| |||| |||||| |||||||||| | ||||||| |||||| | ||||||||||| |||||||||||| |
|
|
| T |
49191551 |
tggaggtttaaggacttggtccttgtacctttacgtggacaattgttctagaaggacaatcatggtcctttgagag |
49191626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University