View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375-Insertion-15 (Length: 296)
Name: NF1375-Insertion-15
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375-Insertion-15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 8 - 296
Target Start/End: Complemental strand, 51154532 - 51154245
Alignment:
| Q |
8 |
cgtaacacacttaacttccctaaaaagttgtacttatttgaactaacaaggtctcgtaggtttgtccataaacataatacattttagatcagttacccga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51154532 |
cgtaacacacttaacttccctaaaaagtcgtacttatttgaactaacaaggtctcgtaggtttgcccataaacataatacattttagatcagttacccga |
51154433 |
T |
 |
| Q |
108 |
ttaaccgatttaaaaagtagtgaatggttcttaactaccgttcacttgcggactgtagttatctatcagtgaagtttagggcttgatgtgcttatgaaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51154432 |
ttaaccgatttaaaaagtagtgaatggttcttaactaccgttcacttgcggactgtagttatctatcagtgaagtttagggcttgatgtgcttatgaaga |
51154333 |
T |
 |
| Q |
208 |
atcctaggcgcctaaagaacaattttgaaattacatttacactatactgaaatagaatcgatatctcatactttgatggttattgttta |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51154332 |
atcctaggcgcctaaagaacaattttgaaattacatttacactatactgaaatagaatcgatatctcatac-ttgatggttattgttta |
51154245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University