View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375-Insertion-18 (Length: 191)
Name: NF1375-Insertion-18
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375-Insertion-18 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 785991 - 786180
Alignment:
| Q |
8 |
tatgattgatttctttgaggc------aaaagttttggatttggtagagatggaaaaggaaatggttggcttcacttttggtttgtgtatgcatttgggc |
101 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785991 |
tatgattgatttctttgaggctttggcaaaagttttggatttggtagagatggaaaaggaaatggttggcttcacttttggtttgtgtatgcatttgggc |
786090 |
T |
 |
| Q |
102 |
aaagatttagccactttcggcaaaacaaagtataggaggaagtgtgcaagcatggctaaagaaaactgatgattttactgaaagatcaac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786091 |
aaagatttagccactttcggcaaaacaaagtataggaggaagtgtgcaagcatggctaaagaaaactgatgattttactgaaagatcaac |
786180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University