View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13750_low_3 (Length: 237)
Name: NF13750_low_3
Description: NF13750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13750_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 100 - 222
Target Start/End: Original strand, 34924878 - 34924996
Alignment:
| Q |
100 |
cttctttcttaagaaagaggtcaacggggggatactgatcaagttgctatgtgaagcttaagatgtgtgacataaacaatttattcttcttaacgaaatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34924878 |
cttctttcttaagaaagaggtcaacggggg-atact---caagttgctatgtgaagcttaagatgtgtgacataaacaatttattcttcttaacgaaatt |
34924973 |
T |
|
| Q |
200 |
ccacttatcttgcaactataaat |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34924974 |
ccacttatcttgcaactataaat |
34924996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 34923930 - 34924011
Alignment:
| Q |
1 |
aatattgaaacaatgaaaaataggaaaaggaaataggtagaaacttcaaagtagaagtaagttgcaatatattgtacttatg |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34923930 |
aatattgaaacaatgaaaaataggaaaaggaaataggtagaaacttcaaagtagaagtaagttgcaatatattgtacttatg |
34924011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University