View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13751_high_8 (Length: 348)
Name: NF13751_high_8
Description: NF13751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13751_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 43439858 - 43440178
Alignment:
| Q |
18 |
atgtaactcataaatgtacattctcnnnnnnngcatgcatagtgtggctttattttgctttaagctattttacatcattatattaattctgtgagtgtta |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439858 |
atgtaactcataaatgtacattctctttttttgcatgcatagtgtggctttattttactttaagctattttacatcattatattaattctgtgagtgtta |
43439957 |
T |
|
| Q |
118 |
tcaagtttgttatttggtatcaagtatcaacatatatatcgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaattggaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439958 |
tcaagtttgttatttggtatcaagtatcaacatatatattgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaattggaaat |
43440057 |
T |
|
| Q |
218 |
aggctttaacaaagaccaagagaggccattgtctcttctatgagtggtgtattgatcctgtattttgcattggtaggccgtaggcatgcgttcccttgag |
317 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43440058 |
aggctttaacaaagaccaagagaggtcattgtctcttctatgagtggtgtattgatcctgtattttgcattggtagggcgtaggcatgcgttcccttgag |
43440157 |
T |
|
| Q |
318 |
cttcctttgcttctcctctct |
338 |
Q |
| |
|
||||||||| || |||||||| |
|
|
| T |
43440158 |
cttcctttgtttttcctctct |
43440178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University