View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13751_low_17 (Length: 268)
Name: NF13751_low_17
Description: NF13751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13751_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 40983363 - 40983605
Alignment:
| Q |
8 |
attattcttggtgatttccctctcctcaggatctacattatccttggacacgttctttcttatgggaaaaacattatccttggactctgtccttttcttc |
107 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983363 |
attatccttggtgatttccctcttctcaggatctacattatccttggacacgttctttcttatgggaaaaacattatccttggactctgtccttttcttc |
40983462 |
T |
|
| Q |
108 |
cttgtaatggcatcattttcttgttcaggtcctttcgctgtgtgaggaaaatgttcaactgtttttctgatcctttgagacgaaacaggcaaaaaattcc |
207 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983463 |
cttataatggcatcattttcttgtttaggtcctttcgctgtgtgaggaaaatgttcaactgtttttctgatcctttgagacgaaacaggcaaaaaattcc |
40983562 |
T |
|
| Q |
208 |
agtgaggtttccttcctttgaggagatcactccaggaaaaagt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983563 |
agtgaggtttccttcctttgaggagatcactccaggaaaaagt |
40983605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University