View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13751_low_24 (Length: 210)
Name: NF13751_low_24
Description: NF13751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13751_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 152 - 194
Target Start/End: Original strand, 16861859 - 16861901
Alignment:
| Q |
152 |
agcattgatacaagagtttcctatgaacctcaatgactatatt |
194 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16861859 |
agcattgatagaagagtttcctatgaacctcaatgactatatt |
16861901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 146
Target Start/End: Complemental strand, 7284944 - 7284868
Alignment:
| Q |
73 |
ccttaattattccttatttagcacgtcatatttttgcataagctca---gttatgtaaaattgacaggctaaacctc |
146 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||| ||||| ||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
7284944 |
ccttaattattctttatttagcacttcaaatttccgcataggctcattggttatgtaacattggcaggctaaacctc |
7284868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University