View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13751_low_25 (Length: 204)
Name: NF13751_low_25
Description: NF13751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13751_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 2 - 166
Target Start/End: Original strand, 41275847 - 41276011
Alignment:
| Q |
2 |
gaaacaagctcactgatgtaataaggcagccaccaaaatttggcaaagggagtagctatgttatacaaaaggaaaataaaatgaacaaagaagatgaaga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41275847 |
gaaacaagctcactgatgtaataaggcagccaccaaaatttggcaaagggagtagctatgttctacaaaaggagaataaaatgaacaaagaagatgaaga |
41275946 |
T |
|
| Q |
102 |
agataatacccctctcatggaaactccagccagactagttttttccaagccaaacaagtcacagg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41275947 |
agataatacccctctcatggaaactccagccagactagttttttccaagccaaacaagtcacagg |
41276011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University