View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13752_high_15 (Length: 257)
Name: NF13752_high_15
Description: NF13752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13752_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 105
Target Start/End: Complemental strand, 33220253 - 33220164
Alignment:
| Q |
16 |
ataccatcaacagtgatgggagatttgattggaacggagagtggggattacatgagctgtgatttaattgatgagcttctagggctaggg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33220253 |
ataccatcaacagtgatgggagatttgattggaacggagagtggggattacatgagctgtgatttaattgatgagcttctagggctaggg |
33220164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 160 - 195
Target Start/End: Complemental strand, 33220109 - 33220074
Alignment:
| Q |
160 |
gtttttccaccggcgataacgttgttgagagaaacc |
195 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33220109 |
gtttttccagcggcgataacgttgttgagagaaacc |
33220074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 218 - 250
Target Start/End: Complemental strand, 33220054 - 33220022
Alignment:
| Q |
218 |
cttcgtgttttaagaaggaatatggtgatgatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
33220054 |
cttcgtgttttaagaaggaatatggtgaagatg |
33220022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University