View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13752_high_15 (Length: 257)

Name: NF13752_high_15
Description: NF13752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13752_high_15
NF13752_high_15
[»] chr3 (3 HSPs)
chr3 (16-105)||(33220164-33220253)
chr3 (160-195)||(33220074-33220109)
chr3 (218-250)||(33220022-33220054)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 105
Target Start/End: Complemental strand, 33220253 - 33220164
Alignment:
16 ataccatcaacagtgatgggagatttgattggaacggagagtggggattacatgagctgtgatttaattgatgagcttctagggctaggg 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33220253 ataccatcaacagtgatgggagatttgattggaacggagagtggggattacatgagctgtgatttaattgatgagcttctagggctaggg 33220164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 160 - 195
Target Start/End: Complemental strand, 33220109 - 33220074
Alignment:
160 gtttttccaccggcgataacgttgttgagagaaacc 195  Q
    ||||||||| ||||||||||||||||||||||||||    
33220109 gtttttccagcggcgataacgttgttgagagaaacc 33220074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 218 - 250
Target Start/End: Complemental strand, 33220054 - 33220022
Alignment:
218 cttcgtgttttaagaaggaatatggtgatgatg 250  Q
    |||||||||||||||||||||||||||| ||||    
33220054 cttcgtgttttaagaaggaatatggtgaagatg 33220022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University