View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13752_low_18 (Length: 284)
Name: NF13752_low_18
Description: NF13752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13752_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 266
Target Start/End: Complemental strand, 2686324 - 2686069
Alignment:
| Q |
11 |
cagagacaaccctcttcaaaattcaaccaatagtcacctcaaaatcggtgacaatggaaacatagtacttctcaattcatcatcagattcagacaacaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686324 |
cagagacaaccctcttcaaaattcaaccaatagtcacctcaaaatcggtgacaatggaaacatagtacttctcaattcatcatcagattcagacaacaac |
2686225 |
T |
|
| Q |
111 |
ctcatatggtcttcgaatcaaacaaaagctaccaacccacttgttcttcagcttttcgataatggaaatttagttctaagagaaacaaacgtgaatgatc |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686224 |
ctcatatggtcttccaatcaaacaaaagctaccaacccacttgttcttcagcttttcgataatggaaatttagttctaagagaaacaaacgtgaatgatc |
2686125 |
T |
|
| Q |
211 |
cgacaaaatatctatggcaaagctttgattatccaacagatactttgttaccatcc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686124 |
cgacaaaatatctatggcaaagctttgattatccaacagatactttgttaccatcc |
2686069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 263
Target Start/End: Original strand, 2669927 - 2669967
Alignment:
| Q |
223 |
tatggcaaagctttgattatccaacagatactttgttacca |
263 |
Q |
| |
|
||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
2669927 |
tatggcagagttttgatcatccaacagatactttgttacca |
2669967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 204 - 262
Target Start/End: Original strand, 36360942 - 36361000
Alignment:
| Q |
204 |
aatgatccgacaaaatatctatggcaaagctttgattatccaacagatactttgttacc |
262 |
Q |
| |
|
|||||||| ||||| | |||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
36360942 |
aatgatccaacaaattttctatggcaaagttttgattaccctacagatactttgttacc |
36361000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University