View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13752_low_24 (Length: 244)

Name: NF13752_low_24
Description: NF13752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13752_low_24
NF13752_low_24
[»] chr4 (1 HSPs)
chr4 (26-153)||(32270152-32270282)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 26 - 153
Target Start/End: Original strand, 32270152 - 32270282
Alignment:
26 cttgatggcaaacatagttctgaagtaaatccaaactgaaaaattacgagtctaacttttgcatgataaaac----atgtgtggtaatttaaaactgaaa 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    ||||||||||||||||||||||||    
32270152 cttgatggcaaacatagttctgaagtaaatccaaactgaaaaattacgagtc-aacttttgcatgataaaactaacatgtgtggtaatttaaaactgaaa 32270250  T
122 cttgaatatttatctaagcaaaaacttaaagg 153  Q
    ||||||||||||||||||||||||||||||||    
32270251 cttgaatatttatctaagcaaaaacttaaagg 32270282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University