View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13754_high_6 (Length: 216)
Name: NF13754_high_6
Description: NF13754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13754_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 14752373 - 14752555
Alignment:
| Q |
13 |
ctttcttcatcatttcctccagtgtgtttgatgatgtcgagttcccatcggcttccataagaataattggaagagttggagatgctgcattgattttgga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14752373 |
ctttcttcatcatttcctccagtgtgtttgatgatgtcgagttcccatcggcttccataagaataattggaagagttggcgatgctgcattgattttgga |
14752472 |
T |
 |
| Q |
113 |
aatgaggggcgaggttgtaaaggcgaggacaggtttggaatccgcgatctgcttcgcgatttcatgtactgtgttgaggggat |
195 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14752473 |
aacgaggggcgaggttgtaaaggcgaggacaggtttggaatccgcgatctgcttcgcgatttcatgtactgtgttgaggggat |
14752555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University