View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13755_high_16 (Length: 280)
Name: NF13755_high_16
Description: NF13755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13755_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 43691405 - 43691668
Alignment:
| Q |
1 |
tctactagtaatggaacaaagtctttttcaa-tttgtcctaaacccttgaaatccatatgttcgccttgattttggccaggaacttctagcattggcctt |
99 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43691405 |
tctactagtaatgaaacaaagtctttttcaaatttgtcctaaacccttgaaatccatatgttcgccttgattttggccaggaacttctagcattggcctt |
43691504 |
T |
|
| Q |
100 |
gtgacttcaacttccagattttcagtttgaccactagatgttgaggaagtagttaagctagtagcttgattcacttgctttttgtattttgacttataaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43691505 |
gtgacttcaacttccagattttcagtttgaccactagatgttgaggaagtagttaagctagtagcttgattcacttgctttttgtattttgacttataaa |
43691604 |
T |
|
| Q |
200 |
atgaaacctctacaccaacaatacaaacatcttttacaagaaacccactatgaggatcatgaag |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43691605 |
atgaaacctctacaccaacaatacaaacatcttttacaagaaacccactatgaggatcatgaag |
43691668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 66
Target Start/End: Original strand, 43696591 - 43696632
Alignment:
| Q |
25 |
ttttcaatttgtcctaaacccttgaaatccatatgttcgcct |
66 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| | |||||| |
|
|
| T |
43696591 |
ttttctatttgtcctaaacccttgaaatccataagctcgcct |
43696632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University