View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13755_high_18 (Length: 251)
Name: NF13755_high_18
Description: NF13755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13755_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 1803310 - 1803532
Alignment:
| Q |
8 |
cttataaattaaatgtctttaagatttttggttaagatgtgttgtcaaactctctcgttttattattcttgatctaatatagtagatgaacccccgtgct |
107 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
1803310 |
cttataaattaaatgtctttaaagtttttggttaagatgtgttgtcaaactctctcgttttattattcttgatctaatatagtagatgaacccctatact |
1803409 |
T |
 |
| Q |
108 |
ttcttcatgacccaacaggcgaccgactccttgtgtcagaagtctttctatcaatggtttcatgcgacatatagctcctacgtgagggagagcataacaa |
207 |
Q |
| |
|
|| |||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1803410 |
tttttcatgacccaacatgtgaccgactccttgtgtcagaagtctttttatcaatggtttcatgcgacatatccctcctacgtgagggagagcataacaa |
1803509 |
T |
 |
| Q |
208 |
aataattgacggacgcacactac |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1803510 |
aataattgacggacgcacactac |
1803532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University