View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13755_low_11 (Length: 388)
Name: NF13755_low_11
Description: NF13755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13755_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 366; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 9 - 382
Target Start/End: Complemental strand, 56470031 - 56469658
Alignment:
| Q |
9 |
ataatacttgtgatgattatatcatttttgacctcttgctgttcatttggggttccatggctatcaaagtgcatcccttgtccttctcatgtgggggatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56470031 |
ataatacttgtgatgattatatcatttttgacctcttgctgttcatttggggttccatggctatcaaagtgcatcccttgtcctcctcatgtgggggatc |
56469932 |
T |
|
| Q |
109 |
agtgcccaaccgtagggcattctggacactacaagaatttccaatgtcctcctaatcactacaatgacctcgcttctctcttttttactaccaacgatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56469931 |
agtgcccaaccgtagggcattctggacactacaagaatttccaatgtcctcctaatcactacaatgacctcgcttctctcttttttactaccaacgatga |
56469832 |
T |
|
| Q |
209 |
tgctatccgcaacctctttattgctggctctaacaaaagattccagctctccagtctcctgatattctttgtggcaatatacttccttggaatcattact |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56469831 |
tgctatccgcaacctctttattgctggctctcacaaaagattccagctctccagtctcctgatattctttgtggcaatatacttccttggaatcattact |
56469732 |
T |
|
| Q |
309 |
tatggcatcgcaattccctcagggttgtttattccagtgatactagcaggggcttcatatgggcgtgttgctgg |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56469731 |
tatggcatcgcaattccctcagggttgtttattccagtgatactagcaggggcttcatatgggcgtgttgctgg |
56469658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 174
Target Start/End: Complemental strand, 47779666 - 47779629
Alignment:
| Q |
137 |
ctacaagaatttccaatgtcctcctaatcactacaatg |
174 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
47779666 |
ctacaagaaattccaatgccctcctaatcactacaatg |
47779629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 174
Target Start/End: Complemental strand, 2334161 - 2334124
Alignment:
| Q |
137 |
ctacaagaatttccaatgtcctcctaatcactacaatg |
174 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
2334161 |
ctacaagaaattccaatgccctcctaatcactacaatg |
2334124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University