View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13755_low_25 (Length: 230)

Name: NF13755_low_25
Description: NF13755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13755_low_25
NF13755_low_25
[»] chr2 (1 HSPs)
chr2 (167-213)||(34337012-34337058)


Alignment Details
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 34337012 - 34337058
Alignment:
167 aagaatggtgctgaattgttgatgaattacgacatagcatccctttt 213  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||    
34337012 aagaatggtgctgaattgttgatgaattatgacatagcatccctttt 34337058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University