View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13755_low_27 (Length: 210)
Name: NF13755_low_27
Description: NF13755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13755_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 2385432 - 2385257
Alignment:
| Q |
16 |
aatactcgaatcaaactagctttaggtgctgcacgaggccttgctcgtatccattccgaaaatggtggaaaacttgtacatggcaatgtcaaatcctcaa |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2385432 |
aatactcggatcaaactagctttaggtgctgcacgaggccttgctcatatccattccaaaaatggtggaaaacttgtacatggcaatgtcaaatcctcaa |
2385333 |
T |
 |
| Q |
116 |
atatctttcttaacactaagcaatacggatgtgtatctcatcttgacttggcaaccataatgagctcagtcgtcca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2385332 |
atatctttcttaacactaagcaatacgggtgtgtttctgatcttggcttggcaaccataatgagctcagtcgtcca |
2385257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 32 - 160
Target Start/End: Original strand, 41730922 - 41731050
Alignment:
| Q |
32 |
tagctttaggtgctgcacgaggccttgctcgtatccattccgaaaatggtggaaaacttgtacatggcaatgtcaaatcctcaaatatctttcttaacac |
131 |
Q |
| |
|
||||||||||||| ||| ||||| |||||| |||||| ||| ||||| || |||||||| |||||||| |||| ||||||||||||||||| || || |
|
|
| T |
41730922 |
tagctttaggtgcagcaagaggcattgctcaaatccatgtcgagaatggcggtaaacttgtccatggcaacatcaagtcctcaaatatctttctcaatac |
41731021 |
T |
 |
| Q |
132 |
taagcaatacggatgtgtatctcatcttg |
160 |
Q |
| |
|
|| ||||| || ||||||||| |||||| |
|
|
| T |
41731022 |
caaacaatatggttgtgtatctgatcttg |
41731050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University