View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13757_high_1 (Length: 241)
Name: NF13757_high_1
Description: NF13757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13757_high_1 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 48681430 - 48681209
Alignment:
| Q |
20 |
tcaagtacttaaagcatatggaacatggagcacctcaagccaagggtgaaaatgatgcataccgtgattttgaccaacctctggagtttccaccttggtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48681430 |
tcaagtacttaaagcatatggaacatggagcacctgaagccaagggtgaaaatgatgcataccgtgattttgaccaacctctggagtttccagcttggtt |
48681331 |
T |
 |
| Q |
120 |
gaatgcaaatgaaagcagcctagagctctgctcggaggataatttccaagattctactttaccttggtaagtctaagttcctcatatatttcataatttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48681330 |
gaatgcaaatgaaagcagcctagagctctgctcggaggataatttccaagattctactttaccttggtaagtctaagttcctcatatatttcataatttt |
48681231 |
T |
 |
| Q |
220 |
taatatgcaccgctttttgttt |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48681230 |
taatatgcaccgctttttgttt |
48681209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University