View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1375R-Insertion-3 (Length: 79)

Name: NF1375R-Insertion-3
Description: NF1375R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1375R-Insertion-3
NF1375R-Insertion-3
[»] chr3 (1 HSPs)
chr3 (9-79)||(30261308-30261378)
[»] chr4 (1 HSPs)
chr4 (45-78)||(35594674-35594707)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 9 - 79
Target Start/End: Complemental strand, 30261378 - 30261308
Alignment:
9 ggttgtcatgagtaccctctctttctggtatggtgctgtgtttactatatgagatcataatctttgtatcc 79  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
30261378 ggttgtcatgagtaccctctctttctagtatggtgctgtgtttactatatgagatcataatctttgtatcc 30261308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 78
Target Start/End: Original strand, 35594674 - 35594707
Alignment:
45 tgtgtttactatatgagatcataatctttgtatc 78  Q
    ||||||||||||||||||| ||||||||||||||    
35594674 tgtgtttactatatgagattataatctttgtatc 35594707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University