View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375R-Insertion-3 (Length: 79)
Name: NF1375R-Insertion-3
Description: NF1375R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375R-Insertion-3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 9 - 79
Target Start/End: Complemental strand, 30261378 - 30261308
Alignment:
| Q |
9 |
ggttgtcatgagtaccctctctttctggtatggtgctgtgtttactatatgagatcataatctttgtatcc |
79 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30261378 |
ggttgtcatgagtaccctctctttctagtatggtgctgtgtttactatatgagatcataatctttgtatcc |
30261308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 78
Target Start/End: Original strand, 35594674 - 35594707
Alignment:
| Q |
45 |
tgtgtttactatatgagatcataatctttgtatc |
78 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
35594674 |
tgtgtttactatatgagattataatctttgtatc |
35594707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University