View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375R-Insertion-5 (Length: 181)
Name: NF1375R-Insertion-5
Description: NF1375R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375R-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 8 - 181
Target Start/End: Complemental strand, 26203324 - 26203151
Alignment:
| Q |
8 |
actaaacaggcaaagaattgacaagctatgaaaaaccaaagcctaatataggaatccacagatatgtgtttgtcctattcaagcnnnnnnngatgaagaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
26203324 |
actaaacaggcaaagaattgacaagctatgaaaaaccaaagcctaatataggaatccacagatatgtgtttgtcctattcaagcaagaaaaggggaagaa |
26203225 |
T |
|
| Q |
108 |
gcactcaattgttgcacctttttcaagggatcactttaacacacgtgccttttctgctcaaaatgaccttggtg |
181 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203224 |
gcactcaattgttgctcctttttcaagggatcactttaacacacgtgccttttctgctcaaaatgaccttggtg |
26203151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University