View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375R-Insertion-8 (Length: 255)
Name: NF1375R-Insertion-8
Description: NF1375R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375R-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 64 - 241
Target Start/End: Complemental strand, 53175086 - 53174909
Alignment:
| Q |
64 |
gtttaagaaaatatggttggaaaaggtggttatgctgaggtttacaagggaacattgaaaaatggtgaagaaattgttatgaagagattaacaagagctt |
163 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
53175086 |
gttttagaaaatatggttggaaaaggtggttatgctgaggtttacaagggaacattgaaaaatggtgaagaaattgctgtgaagagattaacaagagctt |
53174987 |
T |
|
| Q |
164 |
caaaggatgaaagaagagggaaagagtttttgacagagattggaacaattggtcatgttcgtcattccaatgttttat |
241 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174986 |
caaaggatgaaagaaaagagaaagagtttttgacagagattggaacaattggtcatgttcgtcattccaatgttttat |
53174909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 53175148 - 53175112
Alignment:
| Q |
9 |
catagtataatattcatgaaatttttgggaataaaag |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175148 |
catagtataatattcatgaaatttttgggaataaaag |
53175112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University