View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375_high_12 (Length: 293)
Name: NF1375_high_12
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 63 - 191
Target Start/End: Complemental strand, 54275054 - 54274926
Alignment:
| Q |
63 |
tattagtctcgatacccccatagaacatacgaaattccaaaaacacatttttaatattttaattaaaactcaactgatttttaattaaacatgtagaaca |
162 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54275054 |
tattagtctcgatacccccatagaatatacgaaattccaaaaacacatttttaatattttaattaaaactcaactgatttttaattaaacatgtagaaca |
54274955 |
T |
|
| Q |
163 |
taaagatattctaagttttacacaatttt |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
54274954 |
taaagatattctaagttttacaaaatttt |
54274926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 54275089 - 54275052
Alignment:
| Q |
1 |
ctagtcccaacaataaaacacttctctaattgctatat |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54275089 |
ctagtcccaacaataaaacacttctctaattgttatat |
54275052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University