View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375_high_9 (Length: 375)
Name: NF1375_high_9
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 29 - 238
Target Start/End: Complemental strand, 31113163 - 31112954
Alignment:
| Q |
29 |
agtttaggctatgataaaatatcgagtgttttatataaaaaagaagatacctgcaattttttcaagttctcttgtagcttgctttctgccattttagcaa |
128 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31113163 |
agtttaggctatgataaaatatcgtgtgttttatataaaaaagaagatacctgcaattttttcaagttctcttgtagcttgctttctgccattttagcag |
31113064 |
T |
 |
| Q |
129 |
cgcttgtttcctgcagtgtcaccagatacataattgaaacatggttacaacacatttcataaaatcattaaaatcttaaataaatgcaacattattcaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31113063 |
cgcttgtttcctgcagtgtcaccagatacataattgaaacatggttacaacacatttcataaaatcattaaaatcttaaataaatgcaacattattcaaa |
31112964 |
T |
 |
| Q |
229 |
tattactctc |
238 |
Q |
| |
|
|||||||||| |
|
|
| T |
31112963 |
tattactctc |
31112954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 236 - 367
Target Start/End: Complemental strand, 31112874 - 31112743
Alignment:
| Q |
236 |
ctctggctatatacttacattagaggaagaagaaaatccgtatctcttcttgatttggtcgacagtagcaggttgctcttcttgttgttgctcttcttta |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31112874 |
ctctggctatatacttacattagaggaagaagaaaatccgtatctcttcttgatttggtcgacagtagcaggttgctcttcttgttgttgctcttcttta |
31112775 |
T |
 |
| Q |
336 |
gctgatgttttctggatgttacccttcatctc |
367 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
31112774 |
gctgatgttttctggatgttgcccttcatctc |
31112743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 104 - 141
Target Start/End: Original strand, 9706175 - 9706212
Alignment:
| Q |
104 |
agcttgctttctgccattttagcaacgcttgtttcctg |
141 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
9706175 |
agcttgctttctgccaatttagcaacccttgtttcctg |
9706212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University