View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375_low_17 (Length: 357)
Name: NF1375_low_17
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 76 - 342
Target Start/End: Complemental strand, 44709228 - 44708962
Alignment:
| Q |
76 |
catctatggtcttgtcactggtcagtaaaagctccgcctttagtttgatattcatattatgtttaaaaatgatccataatggctctttttgaatggctgc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709228 |
catctatggtcttgtcactggtcagtaaaagctccgcctttagtttgatattcatattatgtttaaaaatgatccataatggctctttttgaatggctgc |
44709129 |
T |
 |
| Q |
176 |
aaatcgcaatgtccccggttttggtgtgacaagatcattgtcagatgaatcagtgacaacatatattttgccagctttgcctcctgttgtgccgtgacca |
275 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709128 |
aaatcgcaatgtccctggttttggtgtgacaagatcattgtcagatgaatcagtgacaacatatattttgccagctttgcctcctgttgtgccgtgacca |
44709029 |
T |
 |
| Q |
276 |
aaaccaagaacacaatctgctagcttcttgcgattcttttcccaatttggatcacatctccagcaac |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709028 |
aaaccaagaacacaatctgctagcttcttgcgattcttttcccaatttggatcacatctccagcaac |
44708962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University