View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375_low_22 (Length: 284)
Name: NF1375_low_22
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 255
Target Start/End: Complemental strand, 36869298 - 36869061
Alignment:
| Q |
16 |
atgagaataattaacacattctattgattgaaggcttctctataatgatttacctattgcacagcgacttgtgaattgtaatcagttacaaagccaatct |
115 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36869298 |
atgagaataatttacacattatgttgattgaaggcttctctataatgatttacctatcgcacagcgacttgtgaattgtaatcaattacaaagccaatct |
36869199 |
T |
|
| Q |
116 |
tgcacttaaagaaatgagttgaaataggcgaatattttattaaacttttgcagttctctgtagtattgtctgagcattttttaaagttatttgaacttgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36869198 |
tgcacttaaagaaatgagttgaaataggcgaatattttattaaacttctgcagttctctgtagtattgtctgagcattttttaaagttatttgaacttgg |
36869099 |
T |
|
| Q |
216 |
acctgtagggtgctaaaacagtagagtggcactgaccttg |
255 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36869098 |
acctgtagggtgctaaaacagt--agtggcactgaccttg |
36869061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University