View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375_low_23 (Length: 280)
Name: NF1375_low_23
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 76 - 251
Target Start/End: Complemental strand, 43598190 - 43598015
Alignment:
| Q |
76 |
aagtgaaaattaagacatacatttaggtttcttggaagttttctttgaatttggaggagattgtccatcttttgatgaagtcatatccatcatggttgct |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598190 |
aagtgaaaattaagacatacatttaggtttcttggaagttttctttgaatttggaggagattgtccatcttttgatgaagtcatatccatcatggttgct |
43598091 |
T |
|
| Q |
176 |
ctttcactttgttattgttattgttaatacgaaatgatgaaaggataattattaagttacattaacatgatggcat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43598090 |
ctttcactttgttattgttattgttaatacgaaatgatgaaaggataattattaagttacattaacatgatggcat |
43598015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University