View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1375_low_30 (Length: 242)
Name: NF1375_low_30
Description: NF1375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1375_low_30 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 242
Target Start/End: Original strand, 53648080 - 53648302
Alignment:
| Q |
21 |
atatggataccattataattgtaagttgtaacatatgcttnnnnnnnntaaagctcatgtaagcatatagattcatagcacgtcctttcatctttgattc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53648080 |
atatggataccattataattgtaagttgtaacatatgcttaaaaaaaataaagctcatgtaagcataaagattcatagcacgtcctttcatctttgattc |
53648179 |
T |
|
| Q |
121 |
ttgacactaattatgaattacttgaattcaccaattttctgagctcgcacataccctttgatcttaaccaatcaaactttattttcattgatcattgtct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53648180 |
ttgacactaattatgaattacttgaattcaccaattttctgagctcgcacataccctttgattttaaccaatcaaactttattttcattgatcattgtct |
53648279 |
T |
|
| Q |
221 |
atctagtcta-tttgaaagacaa |
242 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
53648280 |
atctagtctattttgaaagacaa |
53648302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University