View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13760_high_14 (Length: 267)
Name: NF13760_high_14
Description: NF13760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13760_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 77 - 250
Target Start/End: Complemental strand, 8578889 - 8578716
Alignment:
| Q |
77 |
tggctgatatgaaatcaatcacaattgtattgtagttgtggtaacttgaaaaacaataatgctgctgcattcaagatataaaacttagtcttgaatagtc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8578889 |
tggctgatatgaaatcaatcacaattgtattgtagttgtggtaacttgaaaaacaataatgctgctgcattcaagatataaaacttagtcttgaatagtc |
8578790 |
T |
 |
| Q |
177 |
aactctccacagttcacacgacactcatgcataaattcataaactaaaagataatttttgcttatggatcctct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8578789 |
aactctccacagttcacacgacactcatgcataaattcataaactaaaagataatttttgcttatggatcctct |
8578716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 8584234 - 8584154
Alignment:
| Q |
1 |
caaggttttaaatcacattcacattacgattgtattgcaatctgtgatactatactgcagagtatcacatggaatgtggct |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8584234 |
caaggttttaaatcacattcacgttacgattgtatcgcaatctgtgatactatactgcagagtatcacatggaatgtggct |
8584154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 8553445 - 8553502
Alignment:
| Q |
28 |
gattgtattgcaatctgtgatactatactgcagagtatcacatggaatgtggctgata |
85 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
8553445 |
gattctatcgcaatctgtgatactatactgcagagtatcacatcaaatgtggttgata |
8553502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 189
Target Start/End: Original strand, 8553908 - 8553940
Alignment:
| Q |
157 |
aaacttagtcttgaatagtcaactctccacagt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8553908 |
aaacttagtcttgaatagtcaactctccacagt |
8553940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University