View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13760_high_15 (Length: 265)
Name: NF13760_high_15
Description: NF13760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13760_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 50965129 - 50965366
Alignment:
| Q |
19 |
gttctgacatgttggtttctatgcttttggtcacttaacaaagatgccattacataatcatatctgtgccagctatttggttacttatcatgtcatgttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50965129 |
gttctgacatgttggtttctatgcttttggtcacttaacaaagatgccattacataatcatatctgtgccagctatttggttacttatcatgtcatgttg |
50965228 |
T |
|
| Q |
119 |
gtttctatgctaacaatttggagttgtactccacatgcatcaactattcatcacacgacttcttctgcttgttgggcatgccattacataacaatgttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50965229 |
gtttctatgctaacaatttggagttgtactccacatgcatcaactattcatcacactacttcttctgcttgttgggcatgccattacataacaatgttga |
50965328 |
T |
|
| Q |
219 |
taactccagtaacacactgtgttcaccctggttcatct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50965329 |
taactccagtaacacactgtgttcaccctggttcatct |
50965366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University